You are currently viewing PPM1M Antibody from CUSABIO Technology LLC
cusabio antibody

PPM1M Antibody from CUSABIO Technology LLC

CUSABIO BIOTECH CO., Ltd. is a biotech firm that manufactures and sells the very best high quality analysis, reagents and devices. In collaboration with high stage enterprise companions within the fields of molecular biology, immunology, cell biology and IVD.

They supply services to a broad vary of consumers worldwide–from tutorial and authorities analysis establishments; biotechnology and pharmaceutical firms; in addition to hospitals, reference laboratories. Up to now growth, CUSABIO BIOTECH CO., Ltd. has fashioned an in depth Gross sales and Advertising administration community system serving the Life Science researchers and Healthcare professionals.

The principle merchandise of CUSABIO BIOTECH CO., Ltd. are ELISA kits & relative merchandise and different immunological reagents, reminiscent of antibodies. Their foremost purchasers are professor, researcher, and specialists from College, Hospital, and Analysis Establishment. Their gross sales technique is energetic gross sales, web and by cellphone.

For increasing China market and decreasing manufacturing prices, in August, 2008 CUSABIO BIOTECH CO., Ltd. bought WUHAN HUAMEI BIOTECH CO., Ltd., which turned a completely owned subsidiary. WUHAN HUAMEI BIOTECH CO., Ltd. is positioned in Wuhan, P.R. China and consists of a merchandise and gross sales pressure which offers merchandise for growth of biotechnology in China. CUSABIO BIOTECH CO., Ltd. will develop into an R & D Middle of Life Science.

Their trendy logistics system insures that items will probably be delivered in a well timed method because of at this time’s digital commerce and e-supply. Consequently, this may promote a relentless upgrading of buyer satisfaction within the booming world market.

cusabio
cusabio

Antibodies

All our antibodies listed in a single place for straightforward looking out and discover the proper product sooner and simpler.

 

We recognize your corporation and are dedicated to offering the very best stage of high quality and repair. Our antibodies are assured to work within the utility and species listed on our web site and in our datasheets. Within the case of an antibody not working, our technical division will work with you to troubleshoot the difficulty. If this course of is unsuccessful, G-Biosciences will present you a free substitute or a 100% refund for the antibody.  Our coverage is legitimate for one 12 months from the date of your buy, except in any other case said within the product datasheet.

 

Antibodies might require two weeks for supply.

Cusabio

Cusabio is a number one biotechnology firm established in 2007 and specialised within the manufacturing of high-quality antibodies, ELISA kits, recombinant proteins and small molecules. Cusabio is licensed in keeping with DIN ISO 9001 as their purpose is offering merchandise of the very best high quality by performing strict controls in each step of the event and manufacturing of their merchandise.

Moreover, Cusabio has greater than 60,000 sorts of antibodies. Nearly all of these antibodies are produced polyclonally in rabbit, however additionally they produce polyclonal antibodies made in guinea pig and goat and their antibody portfolio is supplemented with completely different extremely particular mouse monoclonal antibodies. Practically all main antibodies from Cusabio will be delivered as unconjugated antibodies in addition to conjugated to biotin, HRP and FITC in order that the person can select freely concerning the system of detection. As most antibodies of this producer are appropriate for detection of human antigens, the first antibodies from Cusabio which might be accessible at Bio-Join Diagnostics are of nice curiosity for scientists who do analysis in human metabolism, autoimmune ailments, neurobiology and so on.

 

PPM1M antibody

70R-3588 50 ug
EUR 467
Description: Rabbit polyclonal PPM1M antibody raised against the middle region of PPM1M

PPM1M antibody

70R-3594 50 ug
EUR 467
Description: Rabbit polyclonal PPM1M antibody

PPM1M Antibody

1-CSB-PA018499GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PPM1M Polyclonal Antibody

28580-100ul 100ul
EUR 252

PPM1M Polyclonal Antibody

28580-50ul 50ul
EUR 187

PPM1M Polyclonal Antibody

A60378 100 µg
EUR 570.55
Description: fast delivery possible

anti- PPM1M antibody

FNab06690 100µg
EUR 585
  • Immunogen: protein phosphatase 1M(PP2C domain containing)
  • Uniprot ID: Q96MI6
  • Gene ID: 132160
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PPM1M

Anti-PPM1M antibody

PAab06690 100 ug
EUR 412

Anti-PPM1M antibody

STJ116656 100 µl
EUR 277

PPM1M siRNA

20-abx929445
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PPM1M siRNA

20-abx929446
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PPM1M

YF-PA26876 50 ul
EUR 334
Description: Mouse polyclonal to PPM1M

PPM1M Antibody, HRP conjugated

1-CSB-PA842717LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PPM1M Antibody, FITC conjugated

1-CSB-PA842717LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PPM1M Antibody, Biotin conjugated

1-CSB-PA842717LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal PPM1M Antibody (Center)

AMM08666G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPM1M (Center). This antibody is tested and proven to work in the following applications:

PPM1M Polyclonal Conjugated Antibody

C28580 100ul
EUR 397

PPM1M Rabbit pAb

A14446-100ul 100 ul
EUR 308

PPM1M Rabbit pAb

A14446-200ul 200 ul
EUR 459

PPM1M Rabbit pAb

A14446-20ul 20 ul
EUR 183

PPM1M Rabbit pAb

A14446-50ul 50 ul
EUR 223

PPM1M Blocking Peptide

33R-8149 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPM1M antibody, catalog no. 70R-3594

PPM1M Blocking Peptide

33R-9923 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPM1M antibody, catalog no. 70R-3588

PPM1M cloning plasmid

CSB-CL842717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atgggcggctgcacagccctggtggctgtgtccctgcagggaaagctgtacatggccaatgctggggatagcagggccatcttggtgcggagagatgagatacggccactgagcttcgagttcaccccagagactgagcggcagcggatccagcagctggcctttgtctatcctga
  • Show more
Description: A cloning plasmid for the PPM1M gene.

pCMV-SPORT6-PPM1M

PVT13151 2 ug
EUR 391

PPM1M Polyclonal Antibody, Biotin Conjugated

A60379 100 µg
EUR 570.55
Description: reagents widely cited

PPM1M Polyclonal Antibody, FITC Conjugated

A60380 100 µg
EUR 570.55
Description: Ask the seller for details

Leave a Reply